Skip to main content
Check multiplex compatibility of primer sets (v0.4.0)

​
Synopsis

primerlab multiplex --primers <file.json> [options]

​
Description

Analyzes a set of primer pairs for multiplex PCR compatibility by checking cross-dimer formation, Tm uniformity, and GC content consistency.

​
Required Arguments

ArgumentDescription
--primers, -pPath to JSON file containing primer pairs

​
Optional Arguments

ArgumentDefaultDescription
--config, -c-Path to custom YAML config
--output, -omultiplex_outputOutput directory
--formatmarkdownReport format (markdown or json)

​
Examples

​
Basic Usage

# Analyze primers from JSON file
primerlab multiplex --primers my_primers.json

# Specify output directory
primerlab multiplex --primers primers.json --output results/

# Use custom configuration
primerlab multiplex --primers primers.json --config strict_config.yaml

​
Input File Format

Create a JSON file with your primer pairs: 
[
  {
    "name": "GAPDH",
    "fwd": "ATGGGGAAGGTGAAGGTCGG",
    "rev": "GGATCTCGCTCCTGGAAGATG",
    "tm_fwd": 60.5,
    "tm_rev": 61.2,
    "gc_fwd": 60.0,
    "gc_rev": 57.0
  },
  {
    "name": "ACTB",
    "fwd": "CATGTACGTTGCTATCCAGGC",
    "rev": "CTCCTTAATGTCACGCACGAT"
  }
]
Note: tm_fwd, tm_rev, gc_fwd, gc_rev are optional. If not provided, validation rules that depend on these values may flag warnings.

​
Output Files

The command generates the following files in the output directory:
FileDescription
multiplex_report.mdHuman-readable Markdown report
multiplex_analysis.jsonComplete analysis in JSON format
multiplex_analysis.xlsxExcel workbook with matrix (if openpyxl installed)
idt_plate_order.csvIDT plate format for ordering

​
Exit Codes

CodeMeaning
0Analysis complete, primers are compatible
1Analysis complete, primers have compatibility issues

​
Integration with run Command

Use --check-multiplex flag with primerlab run to automatically check designed primers: 
primerlab run pcr --config design.yaml --check-multiplex

​
See Also