Tm Gradient Simulation

Feature documentation: Tm Gradient Simulation

Simulate temperature gradients to find optimal annealing temperatures for primer sets.

Overview

The Tm gradient simulation uses nearest-neighbor thermodynamics to predict primer binding efficiency across a temperature range. This helps determine:

• Optimal annealing temperature for maximum specificity
• Temperature tolerance range for each primer
• Sensitivity analysis to identify temperature-sensitive primers

CLI Usage

primerlab tm-gradient --primers primers.json --min-temp 50 --max-temp 72 --step 0.5

Arguments

Argument	Description	Default
--primers, -p	Path to primers JSON	Required
--template, -t	Template FASTA (optional)	None
--min-temp	Minimum temperature (°C)	50.0
--max-temp	Maximum temperature (°C)	72.0
--step	Temperature step (°C)	0.5
--output, -o	Output directory	tm_gradient_output
--format	Report format (markdown/json/csv)	markdown

Output

🌡️ Tm Gradient Simulation (v0.4.3)
==================================================
📂 Loading primers: primers.json
🔬 Temperature range: 50.0°C - 72.0°C (step 0.5°C)

⏳ Simulating Tm gradient for 3 primers...

==================================================
🎯 Optimal Annealing Temperature: 58.5°C
   Recommended Range: 55.0°C - 62.0°C

📊 Per-Primer Results:
   Primer1_fwd: Tm=62.3°C, Optimal=57.3°C (Grade A)
   Primer1_rev: Tm=60.8°C, Optimal=55.8°C (Grade A)
   ...

📁 Report saved to: tm_gradient_output/tm_gradient.json

API Usage

from primerlab.api import simulate_tm_gradient_api

primers = [
    {"name": "Gene1", "forward": "ATGCGATCGATCGATCGATCG", "reverse": "GCTAGCTAGCTAGCTAGCTAG"}
]

result = simulate_tm_gradient_api(
    primers=primers,
    min_temp=50.0,
    max_temp=72.0,
    step_size=0.5
)

print(f"Optimal annealing: {result['optimal']}°C")
print(f"Range: {result['range_min']} - {result['range_max']}°C")

Thermodynamic Model

Uses Santa Lucia (1998) nearest-neighbor parameters:

• ΔH and ΔS for each dinucleotide pair
• Salt correction for Na+ concentration
• Two-state binding model for efficiency calculation

Configuration

See primerlab/config/tm_gradient_default.yaml for default settings.

See Also

• Tutorial: Tm Gradient Simulation
• Species Specificity