Multiplex Analysis

Feature documentation: Multiplex Analysis

v0.4.0 - Check compatibility of primer sets for multiplex PCR

Overview

PrimerLab’s Multiplex Analysis feature evaluates whether multiple primer pairs can be used together in a single PCR reaction by checking for cross-dimer formation, Tm uniformity, and GC content consistency.

Key Features

Feature	Description
Cross-Dimer Detection	Identifies problematic primer-dimer interactions between all primer combinations
Compatibility Scoring	0-100 score with A-F grading based on dimer ΔG, Tm spread, and GC uniformity
Validation Engine	Configurable thresholds with strict/standard/relaxed presets
Export Formats	JSON, Markdown, Excel (with matrix), IDT plate ordering format

Quick Start

Standalone Analysis

# Basic analysis
primerlab multiplex --primers my_primers.json --output results/

# With custom config
primerlab multiplex --primers primers.json --config my_config.yaml

Integrated with Workflow

# Run PCR design with multiplex check
primerlab run pcr --config design.yaml --check-multiplex

Input Format

Create a JSON file with your primer pairs:

[
  {
    "name": "GAPDH",
    "fwd": "ATGGGGAAGGTGAAGGTCGG",
    "rev": "GGATCTCGCTCCTGGAAGATG",
    "tm_fwd": 60.5,
    "tm_rev": 61.2,
    "gc_fwd": 60.0,
    "gc_rev": 57.0
  },
  {
    "name": "ACTB",
    "fwd": "CATGTACGTTGCTATCCAGGC",
    "rev": "CTCCTTAATGTCACGCACGAT",
    "tm_fwd": 59.8,
    "tm_rev": 58.9,
    "gc_fwd": 52.0,
    "gc_rev": 48.0
  }
]

Output Reports

Format	File	Description
Markdown	multiplex_report.md	Human-readable summary with score, issues, recommendations
JSON	multiplex_analysis.json	Complete data for programmatic use
Excel	multiplex_analysis.xlsx	Summary + Primer Details + Compatibility Matrix sheets
IDT Plate	idt_plate_order.csv	Ready for IDT plate ordering

Scoring System

Grade Thresholds

Score	Grade	Interpretation
85-100	A	Excellent compatibility
70-84	B	Good, minor considerations
55-69	C	Acceptable, some issues
40-54	D	Problematic, redesign recommended
0-39	F	Incompatible, redesign required

Component Weights (Standard Mode)

Component	Weight	Description
Dimer Score	40%	Based on cross-dimer ΔG values
Tm Uniformity	25%	Penalty for Tm spread across primers
GC Uniformity	15%	Penalty for GC content variation
Count Penalty	20%	Penalty for large primer sets (>2 pairs)

Configuration

Preset Modes

multiplex:
  mode: standard  # Options: strict, standard, relaxed

Mode	Dimer ΔG Threshold	Tm Spread Max	Use Case
strict	-5.0 kcal/mol	1.5°C	High-throughput, critical applications
standard	-6.0 kcal/mol	2.0°C	General multiplex PCR
relaxed	-9.0 kcal/mol	3.0°C	Exploratory, non-critical

Custom Thresholds

multiplex:
  mode: standard
  dimer_dg_threshold: -7.0  # Override specific values
  tm_diff_max: 2.5
  
  scoring:
    dimer_weight: 0.45
    tm_weight: 0.25
    gc_weight: 0.15
    count_weight: 0.15

API Usage

from primerlab.api import check_multiplex_compatibility

primers = [
    {"name": "GAPDH", "fwd": "ATGC...", "rev": "GCTA...", "tm_fwd": 60.0, "tm_rev": 60.0},
    {"name": "ACTB", "fwd": "TTTT...", "rev": "AAAA...", "tm_fwd": 59.0, "tm_rev": 59.0},
]

result = check_multiplex_compatibility(primers)

print(f"Score: {result['score']}/100 (Grade {result['grade']})")
print(f"Compatible: {result['is_valid']}")
print(f"Warnings: {result['warnings']}")

Troubleshooting

Common Issues

Issue	Cause	Solution
Score drops with more pairs	Count penalty + more dimer combinations	Split into smaller multiplex groups
Low Tm uniformity score	Large Tm spread across primers	Redesign outlier primers
Problematic dimers	Strong cross-dimer formation	Avoid complementary 3’ ends

Recommendations

1. Optimal set size: 2-5 primer pairs per multiplex
2. Tm target: Keep all primers within 2°C of each other
3. GC content: Aim for 40-60% for all primers
4. 3’ end design: Avoid complementary sequences at 3’ ends

See Also

• CLI Reference
• Configuration Guide
• Troubleshooting