RT-qPCR Primer Validation

Feature documentation: RT-qPCR Primer Validation

Validate RT-qPCR primers for exon-spanning and gDNA contamination risk.

Overview

The RT-qPCR module ensures primers are specific to mRNA:

• Exon Junction Detection - Primers spanning junctions won’t amplify gDNA
• gDNA Risk Assessment - Evaluate contamination risk
• Transcript Annotation - Load exon boundaries from GTF/BED files

Python API

validate_rtpcr_primers_api

from primerlab.api import validate_rtpcr_primers_api

# Define exon boundaries (transcript coordinates)
exon_boundaries = [
    (0, 100),    # Exon 1: 0-100bp
    (100, 200),  # Exon 2: 100-200bp
    (200, 300),  # Exon 3: 200-300bp
]

result = validate_rtpcr_primers_api(
    fwd_sequence="ATGCGATCGATCGATCGATCG",
    fwd_start=90,   # Spans exon1-exon2 junction
    rev_sequence="ATGCGATCGATCGATCG",
    rev_start=150,
    exon_boundaries=exon_boundaries,
)

print(f"RT-specific: {result['is_rt_specific']}")
print(f"Grade: {result['grade']}")
print(f"gDNA Risk: {result['gdna_risk']['risk_level']}")

Exon Junction Spanning

For RT-specificity, primers should span exon-exon junctions:

Position	RT-Specific	gDNA Amplifies
Spans junction	✅ Yes	❌ No
Same exon	❌ No	✅ Yes
Large intron between	✅ Likely	⚠️ Unlikely

gDNA Risk Levels

Risk Level	Meaning	Action
None	Junction-spanning	✅ Safe
Low	Large intron (>1kb)	✅ Acceptable
Medium	Small intron	⚠️ Consider DNase
High	Same exon	❌ Redesign

Optimal Junction Overlap

For reliable RT-specificity, primers should have ≥5bp on each side of junction:

5' exon (≥5bp) | Junction | 3' exon (≥5bp)
     ATGCG     |    ||    |     ATCGA

Use Cases

1. Gene Expression (RT-qPCR) - Ensure cDNA-specific amplification
2. Transcript Variant Detection - Target specific splice isoforms
3. RNA Quality Assessment - Verify no gDNA contamination

See Also

• qPCR Advanced Tutorial
• Melt Curve Analysis