PCR Walkthrough

Tutorial: PCR Walkthrough

Complete end-to-end PCR primer design workflow.

Overview

This tutorial covers:

1. Sequence preparation
2. Configuration options
3. Running design
4. Interpreting results
5. Validation
6. Off-target check

---

1. Sequence Preparation

Check your sequence first

primerlab stats my_gene.fasta

Output:

📊 Sequence Statistics
━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━
Name:     My_Target_Gene
Length:   600 bp
GC:       48.5%
Valid:    ✅ All bases valid

Requirements

• Minimum 100 bp recommended
• FASTA format
• Valid DNA bases (A, T, C, G, or IUPAC codes)

---

2. Configuration Options

Minimal config

workflow: pcr

input:
  sequence_path: "my_gene.fasta"

output:
  directory: "output/"

Full config with all options

workflow: pcr

# Use a preset (optional)
# preset: long_range

input:
  sequence_path: "my_gene.fasta"

parameters:
  # Primer size
  primer_size:
    min: 18
    opt: 20
    max: 24
  
  # Melting temperature
  tm:
    min: 58.0
    opt: 60.0
    max: 62.0
  
  # Product size (can specify multiple ranges)
  product_size_range: [[200, 400], [400, 600]]
  
  # GC content
  gc:
    min: 40
    max: 60

qc:
  mode: standard  # relaxed, standard, strict
  hairpin_dg_max: -2.0
  homodimer_dg_max: -5.0
  heterodimer_dg_max: -5.0

output:
  directory: "output_pcr"

advanced:
  num_candidates: 50
  debug: false

---

3. Running Design

Basic run

primerlab run pcr --config my_config.yaml

With validation

primerlab run pcr --config my_config.yaml --validate

With off-target check

primerlab run pcr --config my_config.yaml --blast --blast-db /path/to/genome

With report

primerlab run pcr --config my_config.yaml --report --report-format html

All options combined

primerlab run pcr \
  --config my_config.yaml \
  --validate \
  --blast --blast-db /path/to/genome \
  --report --report-format html \
  --debug

---

4. Interpreting Results

Output files

output_pcr/
├── result.json        # Machine-readable results
├── report.md          # Human-readable report
├── report.html        # HTML report (if --report-format html)
└── audit.json         # Reproducibility log

Understanding scores

Score	Grade	Meaning
90-100	A	Excellent
80-89	B	Good
70-79	C	Acceptable
60-69	D	Poor
<60	F	Reject

Key metrics

Metric	Ideal	Notes
Tm difference	<2°C	Primers should match
GC content	40-60%	For stability
Hairpin ΔG	>-2 kcal/mol	Avoid stable hairpins
3’ stability	Moderate	Not too stable/weak

---

5. Validation

In-silico PCR

primerlab insilico \
  -f "ATGAGTAAAGGAGAAGAACT" \
  -r "GCCGTGATGTATACATTGTG" \
  -t my_gene.fasta

Check binding

primerlab insilico \
  -p output_pcr/result.json \
  -t my_gene.fasta \
  --show-alignment

---

6. Off-target Check

Setup BLAST database

makeblastdb -in genome.fasta -dbtype nucl -out genome_db

Run check

primerlab blast \
  -p output_pcr/result.json \
  -d genome_db

Interpret grades

Grade	Off-targets	Recommendation
A	0	✅ Use
B	1-2 (low identity)	✅ Use
C	3-5	⚠️ Verify
D	6-10	⚠️ Consider alternatives
F	>10	❌ Do not use

---

Summary Workflow

1. primerlab stats input.fasta     # Check sequence
2. primerlab init --workflow pcr   # Create config template
3. # Edit config as needed
4. primerlab run pcr --config ...  # Design primers
5. primerlab insilico ...          # Validate
6. primerlab blast ...             # Off-target check
7. # Order primers!

---

Next Steps

• qPCR Design
• Presets
• Troubleshooting