Off-target Analysis Tutorial

Tutorial: Off-target Analysis Tutorial

Check primer specificity with BLAST.

Prerequisites

Install BLAST

# Ubuntu/Debian
sudo apt install ncbi-blast+

# macOS
brew install blast

# Verify
blastn -version

Create database

# From genome FASTA
makeblastdb -in genome.fasta -dbtype nucl -out genome_db

# Pre-built databases available at NCBI
# https://ftp.ncbi.nlm.nih.gov/blast/db/

---

Method 1: Integrated with Design

Run off-target check during primer design:

primerlab run pcr \
  --config my_config.yaml \
  --blast \
  --blast-db /path/to/genome_db

Output includes specificity grades:

Primer Pair 1:
  Forward: A (100% specific)
  Reverse: B (1 off-target, low identity)
  Overall: A

---

Method 2: Standalone Check

Check existing primers:

primerlab blast \
  -f "ATGAGTAAAGGAGAAGAACT" \
  -r "GCCGTGATGTATACATTGTG" \
  -d /path/to/genome_db

Or from result file:

primerlab blast \
  -p output_pcr/result.json \
  -d /path/to/genome_db

---

Understanding Results

Grades

Grade	Off-targets	Action
A	0	✅ Safe to use
B	1-2 low identity	✅ Safe to use
C	3-5	⚠️ Verify experimentally
D	6-10	⚠️ Consider alternatives
F	>10	❌ Do not use

Score calculation

Score = 100 - (off_targets × penalty)

Penalty based on:
- Identity (higher = worse)
- 3' match (critical)
- Alignment length

---

Output Files

blast_results/
├── blast_report.json     # Full BLAST results
├── specificity_report.md # Human-readable summary
└── off_targets.fasta     # Off-target sequences

---

Configuration Options

In YAML config:

offtarget:
  enabled: true
  database: "/path/to/genome_db"
  mode: auto  # auto, blast, biopython
  max_targets: 100
  evalue: 10
  threads: 4

---

Troubleshooting

Issue	Solution
Database not found	Check path, run makeblastdb
BLAST not installed	Install ncbi-blast+
Too many off-targets	Try different primer pair
Slow performance	Use —threads option

---

Next Steps

• PCR Walkthrough
• qPCR Design
• Troubleshooting