> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# PCR Walkthrough

> Tutorial: PCR Walkthrough

Complete end-to-end PCR primer design workflow.

## Overview

This tutorial covers:

1. Sequence preparation
2. Configuration options
3. Running design
4. Interpreting results
5. Validation
6. Off-target check

***

## 1. Sequence Preparation

### Check your sequence first

```bash theme={null}
primerlab stats my_gene.fasta
```

Output:

```
📊 Sequence Statistics
━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━
Name:     My_Target_Gene
Length:   600 bp
GC:       48.5%
Valid:    ✅ All bases valid
```

### Requirements

* Minimum 100 bp recommended
* FASTA format
* Valid DNA bases (A, T, C, G, or IUPAC codes)

***

## 2. Configuration Options

### Minimal config

```yaml theme={null}
workflow: pcr

input:
  sequence_path: "my_gene.fasta"

output:
  directory: "output/"
```

### Full config with all options

```yaml theme={null}
workflow: pcr

# Use a preset (optional)
# preset: long_range

input:
  sequence_path: "my_gene.fasta"

parameters:
  # Primer size
  primer_size:
    min: 18
    opt: 20
    max: 24
  
  # Melting temperature
  tm:
    min: 58.0
    opt: 60.0
    max: 62.0
  
  # Product size (can specify multiple ranges)
  product_size_range: [[200, 400], [400, 600]]
  
  # GC content
  gc:
    min: 40
    max: 60

qc:
  mode: standard  # relaxed, standard, strict
  hairpin_dg_max: -2.0
  homodimer_dg_max: -5.0
  heterodimer_dg_max: -5.0

output:
  directory: "output_pcr"

advanced:
  num_candidates: 50
  debug: false
```

***

## 3. Running Design

### Basic run

```bash theme={null}
primerlab run pcr --config my_config.yaml
```

### With validation

```bash theme={null}
primerlab run pcr --config my_config.yaml --validate
```

### With off-target check

```bash theme={null}
primerlab run pcr --config my_config.yaml --blast --blast-db /path/to/genome
```

### With report

```bash theme={null}
primerlab run pcr --config my_config.yaml --report --report-format html
```

### All options combined

```bash theme={null}
primerlab run pcr \
  --config my_config.yaml \
  --validate \
  --blast --blast-db /path/to/genome \
  --report --report-format html \
  --debug
```

***

## 4. Interpreting Results

### Output files

```
output_pcr/
├── result.json        # Machine-readable results
├── report.md          # Human-readable report
├── report.html        # HTML report (if --report-format html)
└── audit.json         # Reproducibility log
```

### Understanding scores

| Score  | Grade | Meaning    |
| ------ | ----- | ---------- |
| 90-100 | A     | Excellent  |
| 80-89  | B     | Good       |
| 70-79  | C     | Acceptable |
| 60-69  | D     | Poor       |
| \<60   | F     | Reject     |

### Key metrics

| Metric        | Ideal        | Notes                 |
| ------------- | ------------ | --------------------- |
| Tm difference | \<2°C        | Primers should match  |
| GC content    | 40-60%       | For stability         |
| Hairpin ΔG    | >-2 kcal/mol | Avoid stable hairpins |
| 3' stability  | Moderate     | Not too stable/weak   |

***

## 5. Validation

### In-silico PCR

```bash theme={null}
primerlab insilico \
  -f "ATGAGTAAAGGAGAAGAACT" \
  -r "GCCGTGATGTATACATTGTG" \
  -t my_gene.fasta
```

### Check binding

```bash theme={null}
primerlab insilico \
  -p output_pcr/result.json \
  -t my_gene.fasta \
  --show-alignment
```

***

## 6. Off-target Check

### Setup BLAST database

```bash theme={null}
makeblastdb -in genome.fasta -dbtype nucl -out genome_db
```

### Run check

```bash theme={null}
primerlab blast \
  -p output_pcr/result.json \
  -d genome_db
```

### Interpret grades

| Grade | Off-targets        | Recommendation           |
| ----- | ------------------ | ------------------------ |
| A     | 0                  | ✅ Use                    |
| B     | 1-2 (low identity) | ✅ Use                    |
| C     | 3-5                | ⚠️ Verify                |
| D     | 6-10               | ⚠️ Consider alternatives |
| F     | >10                | ❌ Do not use             |

***

## Summary Workflow

```
1. primerlab stats input.fasta     # Check sequence
2. primerlab init --workflow pcr   # Create config template
3. # Edit config as needed
4. primerlab run pcr --config ...  # Design primers
5. primerlab insilico ...          # Validate
6. primerlab blast ...             # Off-target check
7. # Order primers!
```

***

## Next Steps

* [qPCR Design](qpcr-design)
* [Presets](/docs/reference/presets)
* [Troubleshooting](/docs/troubleshooting)