> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# Multiplex PCR & Dimer Analysis

> Tutorial: Multiplex PCR & Dimer Analysis

Guide for designing multiplex primer sets and analyzing primer dimers.

***

## Dimer Types

| Type                       | Description                    | Concern Level |
| -------------------------- | ------------------------------ | :-----------: |
| **Self-dimer (Homodimer)** | Primer binds to itself         |     Medium    |
| **Heterodimer**            | Two primers bind to each other |      High     |
| **Hairpin**                | Primer folds on itself         |   Low-Medium  |

***

## Dimer Matrix Analysis

Check compatibility between multiple primers:

```bash theme={null}
primerlab dimer-matrix --primers primers.json --format text
```

### Input Format

```json theme={null}
[
  {"name": "GAPDH_F", "sequence": "ATCGATCGATCGATCGATCG"},
  {"name": "GAPDH_R", "sequence": "GCTAGCTAGCTAGCTAGCTA"},
  {"name": "ACTB_F", "sequence": "TGCATGCATGCATGCATGCA"},
  {"name": "ACTB_R", "sequence": "CGATCGATCGATCGATCGAT"}
]
```

### Output Matrix

```
Dimer Matrix (ΔG kcal/mol)
═══════════════════════════════════════
         GAPDH_F  GAPDH_R  ACTB_F  ACTB_R
GAPDH_F   -2.1     -3.5     -1.2    -0.8
GAPDH_R   -3.5     -1.8     -2.0    -4.1 ⚠️
ACTB_F    -1.2     -2.0     -1.5    -2.3
ACTB_R    -0.8     -4.1 ⚠️  -2.3    -1.9

⚠️ = ΔG < -5.0 (problematic dimer)
```

***

## Compatibility Check

Full multiplex compatibility analysis:

```bash theme={null}
primerlab check-compat --primers primers.csv
```

### Features

* Cross-dimer analysis
* Tm compatibility
* Specificity overlap detection
* Multiplex scoring

***

## Python API

```python theme={null}
from primerlab.core.compat_check import MultiplexValidator

primers = [
    {"name": "P1", "forward": "ATCG...", "reverse": "GCTA..."},
    {"name": "P2", "forward": "TGCA...", "reverse": "CGAT..."},
]

validator = MultiplexValidator()
result = validator.validate(primers)

print(f"Compatible: {result.is_compatible}")
print(f"Score: {result.compatibility_score}/100")
print(f"Problematic pairs: {result.problematic_dimers}")
```

***

## Multiplex Design Tips

### Tm Matching

All primers should have similar Tm (within ±2°C):

```
Good:  P1=60°C, P2=59°C, P3=61°C (Δ2°C)
Bad:   P1=60°C, P2=55°C, P3=65°C (Δ10°C)
```

### Avoid Cross-Reactivity

* Use species-check for each primer pair
* Verify no off-target binding to other amplicons

### Amplicon Size Separation

For gel visualization, use distinct sizes:

```
P1: 150 bp
P2: 250 bp  (+100)
P3: 400 bp  (+150)
```

***

## Thresholds

| Metric         |  Good  |    Warning   |   Fail  |
| -------------- | :----: | :----------: | :-----: |
| Heterodimer ΔG | > -5.0 | -5.0 to -7.0 | \< -7.0 |
| Homodimer ΔG   | > -5.0 | -5.0 to -7.0 | \< -7.0 |
| Hairpin ΔG     | > -2.0 | -2.0 to -4.0 | \< -4.0 |
| Tm difference  | \< 2°C |     2-4°C    |  > 4°C  |

***

## See Also

* [CLI: check-compat](/docs/reference/cli/compat_check)
* [CLI: dimer-matrix](#)
* [Features: Compatibility Check](/docs/concepts/features/compat_check)