> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# primerlab species-check

> CLI reference for the primerlab species-check command

Check primer specificity across multiple species templates.

## Synopsis

```bash theme={null}
primerlab species-check --primers FILE --target FILE [OPTIONS]
```

## Description

The `species-check` command analyzes primer binding across target and off-target species to ensure specificity. It calculates binding scores, identifies cross-reactivity risks, and generates detailed reports.

## Arguments

| Argument        | Required | Description                                                    |
| --------------- | -------- | -------------------------------------------------------------- |
| `--primers, -p` | Yes      | Path to primers JSON file                                      |
| `--target, -t`  | Yes      | Path to target species FASTA                                   |
| `--offtargets`  | No       | Comma-separated off-target FASTA files                         |
| `--output, -o`  | No       | Output directory (default: species\_check\_output)             |
| `--format`      | No       | Report format: markdown, json, excel, html (default: markdown) |
| `--primers-dir` | No       | Directory with multiple primer JSON files (batch mode)         |
| `--parallel`    | No       | Number of threads for batch processing (default: 4)            |
| `--no-cache`    | No       | Disable SQLite caching                                         |

## Examples

### Basic Usage

```bash theme={null}
primerlab species-check \
  --primers primers.json \
  --target human_template.fasta
```

### With Off-targets

```bash theme={null}
primerlab species-check \
  --primers primers.json \
  --target human.fasta \
  --offtargets mouse.fasta,rat.fasta \
  --output results/
```

### Batch Mode

```bash theme={null}
primerlab species-check \
  --primers-dir primers_directory/ \
  --target human.fasta \
  --parallel 4 \
  --output batch_results/
```

### HTML Report

```bash theme={null}
primerlab species-check \
  --primers primers.json \
  --target human.fasta \
  --format html
```

## Input Format

### primers.json

```json theme={null}
[
  {"name": "Gene1", "forward": "ATGCGATCGATCGATCGATCG", "reverse": "CGATCGATCGATCGATCGCAT"},
  {"name": "Gene2", "forward": "GCTAGCTAGCTAGCTAGCTAG", "reverse": "TAGCTAGCTAGCTAGCTAGCT"}
]
```

### FASTA Files

```
>SpeciesName
ATGCGATCGATCGATCGATCG...
```

## Output

### Console Output

```
🧬 Species Specificity Check (v0.4.3)
==================================================
📂 Loading primers: primers.json
🎯 Target: Human (350 bp)
🔬 Off-targets: Mouse, Rat

⏳ Analyzing 2 primer pairs...

==================================================
📊 Specificity Results:
   Gene1: Score 95.0 (Grade A) ✅ SPECIFIC
   Gene2: Score 87.5 (Grade B) ✅ SPECIFIC

🎯 Overall: 91.3 (Grade A)
   Specific: 2/2 (100%)

📁 Report saved to: species_check_output/species_analysis.md
```

### Report Files

* `species_analysis.json` - Full JSON data
* `species_analysis.md` - Markdown report
* `species_analysis.html` - HTML report
* `species_analysis.xlsx` - Excel workbook

## Scoring

| Score | Grade | Meaning                   |
| ----- | ----- | ------------------------- |
| ≥90   | A     | Excellent specificity     |
| 80-89 | B     | Good specificity          |
| 70-79 | C     | Acceptable                |
| 60-69 | D     | Poor - review recommended |
| \<60  | F     | Fail - redesign required  |

## See Also

* [Species Specificity Feature](/docs/concepts/features/species-specificity)
* [Species Check Tutorial](/docs/tutorials/species-check)
* [Batch Processing](/docs/concepts/features/batch-processing)