> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# primerlab probe-check

> CLI reference for the primerlab probe-check command

Check TaqMan probe binding efficiency and thermodynamics (v0.6.0).

## Usage

```bash theme={null}
primerlab probe-check --probe <SEQUENCE> [OPTIONS]
```

## Arguments

| Argument           | Required | Description                             |
| ------------------ | -------- | --------------------------------------- |
| `--probe`, `-p`    | Yes      | Probe sequence (5'→3')                  |
| `--amplicon`, `-a` | No       | Amplicon sequence for position analysis |
| `--min-temp`       | No       | Minimum temperature (default: 55°C)     |
| `--max-temp`       | No       | Maximum temperature (default: 72°C)     |
| `--output`, `-o`   | No       | Output file path                        |
| `--format`         | No       | Output format: `text` or `json`         |

## Examples

### Basic probe check

```bash theme={null}
primerlab probe-check --probe ATGCGATCGATCGATCGATCG
```

Output:

```
═══════════════════════════════════════════════════════
                   PROBE BINDING CHECK (v0.6.0)
═══════════════════════════════════════════════════════
Probe:    ATGCGATCGATCGATCGATCG
Length:   21 bp

Results:
  Binding Tm:     65.2°C
  Grade:          A
  Quality Score:  92/100
```

### With amplicon context

```bash theme={null}
primerlab probe-check \
  --probe ATGCGATCGATCGATCGATCG \
  --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
```

### JSON output

```bash theme={null}
primerlab probe-check --probe ATGCGATCGATCGATCGATCG --format json
```

### Save to file

```bash theme={null}
primerlab probe-check --probe ATGCGATCGATCGATCGATCG -o probe_result.txt
```

## Output Fields

| Field         | Description                                  |
| ------------- | -------------------------------------------- |
| Binding Tm    | Melting temperature of probe-target hybrid   |
| Grade         | Quality grade (A-F)                          |
| Quality Score | Overall score (0-100)                        |
| Position      | Probe position within amplicon (if provided) |

## See Also

* [melt-curve](melt-curve) - SYBR melt curve prediction
* [amplicon-qc](amplicon-qc) - Amplicon quality check
* [Probe Binding Feature](/docs/concepts/features/probe-binding)