> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# primerlab melt-curve

> CLI reference for the primerlab melt-curve command

Predict SYBR Green melt curve for amplicon analysis (v0.6.0).

## Usage

```bash theme={null}
primerlab melt-curve --amplicon <SEQUENCE> [OPTIONS]
```

## Arguments

| Argument           | Required | Description                                 |
| ------------------ | -------- | ------------------------------------------- |
| `--amplicon`, `-a` | Yes      | Amplicon sequence or FASTA file path        |
| `--output`, `-o`   | No       | Output file path for plot                   |
| `--format`         | No       | Output format: `text`, `json`, `svg`, `png` |
| `--min-temp`       | No       | Minimum temperature (default: 65°C)         |
| `--max-temp`       | No       | Maximum temperature (default: 95°C)         |

## Examples

### Basic melt curve prediction

```bash theme={null}
primerlab melt-curve --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCG
```

Output:

```
═══════════════════════════════════════════════════════
                   MELT CURVE PREDICTION (v0.6.0)
═══════════════════════════════════════════════════════
Amplicon Length:  33 bp
Predicted Tm:     72.5°C
Tm Range:         70.0 - 75.0°C
Single Peak:      ✅ Yes
Quality Score:    95/100
Grade:            A
```

### Generate SVG plot

```bash theme={null}
primerlab melt-curve \
  --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCG \
  --format svg \
  --output melt_curve.svg
```

### Generate PNG plot

```bash theme={null}
primerlab melt-curve \
  --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCG \
  --format png \
  --output melt_curve.png
```

### From FASTA file

```bash theme={null}
primerlab melt-curve --amplicon amplicon.fasta --format json
```

### JSON output

```bash theme={null}
primerlab melt-curve --amplicon ATGCGATCGATCGATCGATCG --format json
```

## Output Fields

| Field         | Description                                 |
| ------------- | ------------------------------------------- |
| Predicted Tm  | Primary melting temperature                 |
| Tm Range      | Expected Tm variation                       |
| Single Peak   | Whether curve shows single specific product |
| Quality Score | Overall score (0-100)                       |
| Grade         | Quality grade (A-F)                         |

## Output Formats

| Format | Description                       |
| ------ | --------------------------------- |
| `text` | Human-readable summary (default)  |
| `json` | Full data as JSON                 |
| `svg`  | Vector plot (no dependencies)     |
| `png`  | Raster plot (requires matplotlib) |

## See Also

* [probe-check](probe-check) - TaqMan probe binding
* [amplicon-qc](amplicon-qc) - Amplicon quality check
* [Melt Curve Feature](/docs/concepts/features/melt-curve)