> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# primerlab insilico

> CLI reference for the primerlab insilico command

**v0.2.4** - In-silico PCR Simulation

Validate primers against a template sequence by simulating PCR amplification.

## Usage

```bash theme={null}
primerlab insilico -p <primers> -t <template> [options]
```

## Arguments

| Argument     | Short | Required | Description                                   |
| ------------ | ----- | -------- | --------------------------------------------- |
| `--primers`  | `-p`  | ✅        | Path to primers file (JSON or FASTA)          |
| `--template` | `-t`  | ✅        | Path to template FASTA file                   |
| `--output`   | `-o`  | ❌        | Output directory (default: `insilico_output`) |
| `--config`   | `-c`  | ❌        | Optional config file for parameters           |
| `--json`     |       | ❌        | Output results as JSON only                   |
| `--circular` |       | ❌        | Treat template as circular (v0.2.4)           |

## Primer File Formats

### JSON Format

```json theme={null}
{
  "forward": "ATGGTGAGCAAGGGCGAGGAG",
  "reverse": "TTACTTGTACAGCTCGTCCATGCC"
}
```

### FASTA Format

```fasta theme={null}
>Forward_primer
ATGGTGAGCAAGGGCGAGGAG
>Reverse_primer
TTACTTGTACAGCTCGTCCATGCC
```

## Examples

### Basic Usage

```bash theme={null}
primerlab insilico -p primers.json -t template.fasta
```

### With Custom Output Directory

```bash theme={null}
primerlab insilico -p primers.json -t template.fasta -o results/
```

### JSON Output for Pipelines

```bash theme={null}
primerlab insilico -p primers.json -t template.fasta --json > result.json
```

### Using Example Files

```bash theme={null}
primerlab insilico \
  -p examples/insilico/primers.json \
  -t examples/insilico/template.fasta
```

## Output Files

| File                        | Description                             |
| --------------------------- | --------------------------------------- |
| `insilico_result.json`      | Complete results with binding data      |
| `insilico_report.md`        | Human-readable markdown report (v0.2.2) |
| `predicted_amplicons.fasta` | Predicted amplicon sequences            |

## Console Output

```
============================================================
🧬 In-silico PCR Results
============================================================
Template: GFP_coding_sequence (720 bp)
Forward:  5'-ATGGTGAGCAAGGGCGAGGAG-3' (21 bp)
Reverse:  5'-TTACTTGTACAGCTCGTCCATGCC-3' (24 bp)
------------------------------------------------------------

✅ 1 product(s) predicted

🎯 PRIMARY: 720 bp
   Position: 0 → 720
   Likelihood: 100.0%

   Amplicon: ATGGTGAGCAAGGGCGAGGAG...GGCATGGACGAGCTGTACAAGTAA

------------------------------------------------------------
📁 Output directory: insilico_output
   • insilico_result.json
   • predicted_amplicons.fasta (1 sequences)
```

## What It Checks

* **Primer Binding Sites** - Finds all positions where primers can bind
* **3' End Match** - Verifies 3' stability (minimum 3bp perfect match)
* **5' Mismatch Tolerance** - Allows up to 2 mismatches at 5' end
* **Product Size** - Validates amplicon is within expected range
* **Multiple Products** - Detects potential non-specific amplification
* **Orientation** - Ensures primers face each other correctly

## Related Commands

* [`primerlab run`](run) - Design primers
* [`primerlab stats`](stats) - Sequence statistics
* [`primerlab validate`](validate) - Validate config files