> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# primerlab multiplex

> CLI reference for the primerlab multiplex command

> Check multiplex compatibility of primer sets (v0.4.0)

## Synopsis

```bash theme={null}
primerlab multiplex --primers <file.json> [options]
```

## Description

Analyzes a set of primer pairs for multiplex PCR compatibility by checking cross-dimer formation, Tm uniformity, and GC content consistency.

## Required Arguments

| Argument          | Description                               |
| ----------------- | ----------------------------------------- |
| `--primers`, `-p` | Path to JSON file containing primer pairs |

## Optional Arguments

| Argument         | Default            | Description                          |
| ---------------- | ------------------ | ------------------------------------ |
| `--config`, `-c` | -                  | Path to custom YAML config           |
| `--output`, `-o` | `multiplex_output` | Output directory                     |
| `--format`       | `markdown`         | Report format (`markdown` or `json`) |

## Examples

### Basic Usage

```bash theme={null}
# Analyze primers from JSON file
primerlab multiplex --primers my_primers.json

# Specify output directory
primerlab multiplex --primers primers.json --output results/

# Use custom configuration
primerlab multiplex --primers primers.json --config strict_config.yaml
```

### Input File Format

Create a JSON file with your primer pairs:

```json theme={null}
[
  {
    "name": "GAPDH",
    "fwd": "ATGGGGAAGGTGAAGGTCGG",
    "rev": "GGATCTCGCTCCTGGAAGATG",
    "tm_fwd": 60.5,
    "tm_rev": 61.2,
    "gc_fwd": 60.0,
    "gc_rev": 57.0
  },
  {
    "name": "ACTB",
    "fwd": "CATGTACGTTGCTATCCAGGC",
    "rev": "CTCCTTAATGTCACGCACGAT"
  }
]
```

**Note:** `tm_fwd`, `tm_rev`, `gc_fwd`, `gc_rev` are optional. If not provided, validation rules that depend on these values may flag warnings.

## Output Files

The command generates the following files in the output directory:

| File                      | Description                                        |
| ------------------------- | -------------------------------------------------- |
| `multiplex_report.md`     | Human-readable Markdown report                     |
| `multiplex_analysis.json` | Complete analysis in JSON format                   |
| `multiplex_analysis.xlsx` | Excel workbook with matrix (if openpyxl installed) |
| `idt_plate_order.csv`     | IDT plate format for ordering                      |

## Exit Codes

| Code | Meaning                                              |
| ---- | ---------------------------------------------------- |
| 0    | Analysis complete, primers are compatible            |
| 1    | Analysis complete, primers have compatibility issues |

## Integration with `run` Command

Use `--check-multiplex` flag with `primerlab run` to automatically check designed primers:

```bash theme={null}
primerlab run pcr --config design.yaml --check-multiplex
```

## See Also

* [Multiplex Feature Guide](/docs/concepts/features/multiplex)
* [Configuration Reference](#)