> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# primerlab amplicon-qc

> CLI reference for the primerlab amplicon-qc command

Validate qPCR amplicon quality and characteristics (v0.6.0).

## Usage

```bash theme={null}
primerlab amplicon-qc --amplicon <SEQUENCE> [OPTIONS]
```

## Arguments

| Argument           | Required | Description                          |
| ------------------ | -------- | ------------------------------------ |
| `--amplicon`, `-a` | Yes      | Amplicon sequence or FASTA file path |
| `--min-length`     | No       | Minimum length (default: 70 bp)      |
| `--max-length`     | No       | Maximum length (default: 150 bp)     |
| `--output`, `-o`   | No       | Output file path                     |
| `--format`         | No       | Output format: `text` or `json`      |

## Examples

### Basic amplicon QC

```bash theme={null}
primerlab amplicon-qc --amplicon ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
```

Output:

```
═══════════════════════════════════════════════════════
                   AMPLICON QC (v0.6.0)
═══════════════════════════════════════════════════════
Length:           97 bp
GC Content:       50.5%
Amplicon Tm:      73.7°C

Validation:
  Length OK:      ✅
  GC OK:          ✅
  Structure OK:   ✅

Quality Score:    95/100
Grade:            A
```

### Custom length range

```bash theme={null}
primerlab amplicon-qc \
  --amplicon ATGCGATCGATCGATCGATCG \
  --min-length 50 \
  --max-length 200
```

### From FASTA file

```bash theme={null}
primerlab amplicon-qc --amplicon amplicon.fasta
```

### JSON output

```bash theme={null}
primerlab amplicon-qc --amplicon ATGCGATCGATCGATCGATCG --format json -o result.json
```

## Validation Criteria

| Criterion           | Optimal Range    | Description                |
| ------------------- | ---------------- | -------------------------- |
| Length              | 70-150 bp        | qPCR optimal amplicon size |
| GC Content          | 40-60%           | Balanced base composition  |
| Secondary Structure | ΔG > -3 kcal/mol | Minimal self-folding       |

## Output Fields

| Field         | Description                      |
| ------------- | -------------------------------- |
| Length        | Amplicon length in bp            |
| GC Content    | Percentage of G+C bases          |
| Amplicon Tm   | Predicted melting temperature    |
| Length OK     | Passes length validation         |
| GC OK         | Passes GC content validation     |
| Structure OK  | Passes secondary structure check |
| Quality Score | Overall score (0-100)            |
| Grade         | Quality grade (A-F)              |

## See Also

* [probe-check](probe-check) - TaqMan probe binding
* [melt-curve](melt-curve) - SYBR melt curve prediction
* [qPCR Advanced Tutorial](/docs/tutorials/qpcr-advanced)