> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# RT-qPCR Primer Validation

> Feature documentation: RT-qPCR Primer Validation

Validate RT-qPCR primers for exon-spanning and gDNA contamination risk.

## Overview

The RT-qPCR module ensures primers are specific to mRNA:

* **Exon Junction Detection** - Primers spanning junctions won't amplify gDNA
* **gDNA Risk Assessment** - Evaluate contamination risk
* **Transcript Annotation** - Load exon boundaries from GTF/BED files

## Python API

### validate\_rtpcr\_primers\_api

```python theme={null}
from primerlab.api import validate_rtpcr_primers_api

# Define exon boundaries (transcript coordinates)
exon_boundaries = [
    (0, 100),    # Exon 1: 0-100bp
    (100, 200),  # Exon 2: 100-200bp
    (200, 300),  # Exon 3: 200-300bp
]

result = validate_rtpcr_primers_api(
    fwd_sequence="ATGCGATCGATCGATCGATCG",
    fwd_start=90,   # Spans exon1-exon2 junction
    rev_sequence="ATGCGATCGATCGATCG",
    rev_start=150,
    exon_boundaries=exon_boundaries,
)

print(f"RT-specific: {result['is_rt_specific']}")
print(f"Grade: {result['grade']}")
print(f"gDNA Risk: {result['gdna_risk']['risk_level']}")
```

## Exon Junction Spanning

For RT-specificity, primers should span exon-exon junctions:

| Position             | RT-Specific | gDNA Amplifies |
| -------------------- | ----------- | -------------- |
| Spans junction       | ✅ Yes       | ❌ No           |
| Same exon            | ❌ No        | ✅ Yes          |
| Large intron between | ✅ Likely    | ⚠️ Unlikely    |

## gDNA Risk Levels

| Risk Level | Meaning             | Action            |
| ---------- | ------------------- | ----------------- |
| None       | Junction-spanning   | ✅ Safe            |
| Low        | Large intron (>1kb) | ✅ Acceptable      |
| Medium     | Small intron        | ⚠️ Consider DNase |
| High       | Same exon           | ❌ Redesign        |

## Optimal Junction Overlap

For reliable RT-specificity, primers should have ≥5bp on each side of junction:

```
5' exon (≥5bp) | Junction | 3' exon (≥5bp)
     ATGCG     |    ||    |     ATCGA
```

## Use Cases

1. **Gene Expression (RT-qPCR)** - Ensure cDNA-specific amplification
2. **Transcript Variant Detection** - Target specific splice isoforms
3. **RNA Quality Assessment** - Verify no gDNA contamination

## See Also

* [qPCR Advanced Tutorial](/docs/tutorials/qpcr-advanced)
* [Melt Curve Analysis](melt-curve)