> ## Documentation Index
> Fetch the complete documentation index at: https://primerlab-genomic.mintlify.site/llms.txt
> Use this file to discover all available pages before exploring further.

# Probe Binding Simulation

> Feature documentation: Probe Binding Simulation

Simulate TaqMan probe binding using nearest-neighbor thermodynamics.

## Overview

The probe binding module calculates probe-template binding characteristics:

* **Probe Tm** - Melting temperature using nearest-neighbor method
* **Binding Efficiency** - Efficiency across temperature range
* **Position Analysis** - Optimal probe placement within amplicon

## Python API

### simulate\_probe\_binding\_api

```python theme={null}
from primerlab.api import simulate_probe_binding_api

result = simulate_probe_binding_api(
    probe_sequence="ATGCGATCGATCGATCGATCG",
    amplicon_sequence="...",  # Optional
    min_temp=55.0,
    max_temp=72.0,
)

print(f"Probe Tm: {result['probe_tm']}°C")
print(f"Optimal: {result['optimal_temp']}°C")
print(f"Grade: {result['grade']}")
```

### Core Functions

```python theme={null}
from primerlab.core.qpcr import (
    calculate_probe_binding_tm,
    simulate_probe_binding,
    analyze_probe_position,
    optimize_probe_position,
)

# Calculate Tm
tm = calculate_probe_binding_tm("ATGCGATCGATCGATCGATCG")

# Full simulation
result = simulate_probe_binding("ATGCGATCGATCGATCGATCG")
print(f"Binding curve: {len(result.binding_curve)} points")
```

## Probe Design Guidelines

### TaqMan Probe Requirements

| Property | Optimal  | Acceptable |
| -------- | -------- | ---------- |
| Length   | 18-24 bp | 15-30 bp   |
| Tm       | 68-70°C  | 65-72°C    |
| GC%      | 40-60%   | 30-80%     |
| 5' base  | Not G    | Any        |

### Tm Relationship

* Probe Tm should be **8-10°C higher** than primer Tm
* Ensures probe binds before primers during annealing

### 5' G Rule

Avoid G at the 5' end of the probe:

* G can quench FAM fluorescence even when free
* Reduces signal-to-noise ratio

## Output

### ProbeBindingResult

```python theme={null}
@dataclass
class ProbeBindingResult:
    probe_sequence: str
    probe_tm: float
    binding_efficiency: float
    optimal_temp: float
    binding_curve: List[Dict]
    warnings: List[str]
    grade: str
    score: float
```

## See Also

* [qPCR Workflow](/docs/tutorials/qpcr-design)
* [Melt Curve Analysis](melt-curve)